Interpreting Proteobacteria diversity through 16S rRNA analysis in Manasbal Lake, Kashmir

1 Postgraduate Department of Environmental Science, S.P. College Srinagar-190001, India.

2 Department of Environmental Science, Govt. Degree College DH Pora Kulgam Kashmir-192301, India.

*Corresponding Author: Suhaib A. Bandh ([email protected])

1. Introduction

Phylum proteobacteria representing various gram-negative bacteria comprise the largest cultured bacterial group within prokaryotes[1]. Using 16SrRNA gene sequence structures, the taxonomic origin of proteobacteria as purple bacteria is defined to possess four bacterial groups [2]. representing five classes including Alpha-proteobacteria, Beta-proteobacteria, and Gamma-proteobacteria Delta-proteobacteria and Epsilon-proteobacteria [3]. Gamma-proteobacteria is represented by purple sulfur bacteria while alpha and beta–purple non-sulfur bacteria represent proteobacteria. Because of their pathogenicity to humans, animals and plants, the proteobacteria are of greater biological significance [4]. Additionally, the species of this group have contributions towards the origin of eukaryotic cells and their organelles[5]. Proteobacteria possess a high metabolic diversity including the chemoorganotrophic, chemoautotrophic, and phototrophic bacteria, which are of greater significance in agricultural, medical, and industrial fields [6]. Further, different species have been placed in this bacterial group based on 16S rRNA oligonucleotide catalogues, rRNA cistron similarities, phylogenetic analysis, and DNA-rRNA hybridization [7]. Class Alpha-proteobacteria (α) includes most of the species that are capable of growing in oligotrophic environments. Members of this group, which include some human and plant pathogens as well as some symbionts have extraordinary morphologies, like stalk and prostheca. Class beta-proteobacteria (β) is similar to alpha-proteobacteria, i.e. they grow on very small amounts of nutrients, but the majority of organisms grow in anaerobic environments on the leached nutrients. Gamma-proteobacteria class (γ), characterized by exceptional diversity is considered as the broadest proteobacteria subgroup, with 14 orders and 25 families [8].

2. Materials and Methods

2.1 Description of study area:

Manasbal Lake, located at 34°14’40”-34°15’20″N and 74°39’00”-74°14’20″E, is the deepest of all freshwater lakes of Kashmir with a depth of around 12 meters [9]. While springs are the main water supply, it is also fed by a seasonal irrigation canal (Laar-Kul) on its eastern side. Since the lake water is used for various purposes like drinking, washing, swimming, leisure and agricultural activities, it acts as a natural water reserve for the locals in the area [10]. For the current study, a total of ten sampling stations as areas of special environmental interests and according to the human interference (Table 1; Fig. 1) were selected in the lake to collect the water samples for the isolation of proteobacterial community composition.

2.2 Sample Collection

Water samples were collected seasonally for a period of two years from the previously selected sites of the lake in polyethylene (PET) bottles, which were previously carefully cleaned three to four times by autoclaved water and 70 percent alcohol. The container was rinsed with lake water thrice at the time of collection, and the samples were collected.

2.3 Bacterial isolation

For the isolation of bacteria, the collected water samples were serially diluted four-folds using the normal saline solution (0.85%) followed by direct plating method [11], spreading 0.1ml inoculum from the serial dilution tubes (Clesceri,1998) on Petri dishes containing nutrient agar medium [12]. The inoculated plates were incubated at a temperature of 37 °C for 24–48 h.

For bacterial isolation, the collected water samples were serially diluted four times by a normal saline solution (0.85%). Using the direct plating method [13] 0.1 ml of the serially diluted inoculum was spread on Petri plates containing a nutrient agar medium [14]. The inoculated Petri plates were incubated at a temperature of 37°C for 24–48 hours for the proper isolation of bacteria.

Fig. 1 Map of Study Area (Manasbal Lake J&K India)

Table 1. Study site description of Manasbal Lake

2.4 Bacterial Identification by different approaches

2.4.1 Morphological

Tests were carried out to classify bacteria through direct microscopy and motility. Samples were stained and examined for the dimensions, shapes and arrangements etc. to study the micro- and macro-morphological characteristics of bacteria. In order to obtain pure cultures, all recognizable colonies were streaked and re-streaked on the required media. Motility testing of cultures was done by using motility agar media [15].

2.4.2 Biochemical

Every single strain to be used for biochemical profiling was first purified by the technique of pure culture. Each isolated strains were first cultivated in Nutrient Agar and then a well-isolated colony was taken in 10ml nutrient broth for the preparation of a homogenous suspension to be incubated for 4-6 hours at 35-37°C. The biochemical tests conducted included Indole, Nitrate and Hydrogen sulphide production testing, Voges-proskauer, Citrate, Catalase, Amylase and Nitrate[16].

2.4.3 Molecular

For the proper conduct of molecular operations on the isolated bacterial strains, each of them was grown afresh on nutrient agar medium for 24 hours. The HiPurA bacterial and yeast genomic DNA mini-prep purification spin kit (Hi–Media, Lot MB505) was used for DNA extraction in accordance with the manufacturer’s instructions. Following the extraction of DNA, 16S rRNA gene was amplified using universal bacterial primers 27F(Forward 5′– AGAGTTTGATCCTGGCTCAG–3′ and Reverse 1429R (5’GGTTACCTTGTTACGACTT 3′). Amplification was performed in a thermal cycler in PCR reaction tubes containing 50μl reaction mixture (table 2) with initial denaturation at 94°C for 5 minutes, 30 denaturation cycles at 94°C for 1 minute, annealing at 55°C for 45 seconds, extension at 72°C for 45 seconds and final extension at 72°C for 10 minutes. PCR products were sent for sequencing to SciGenom Laboratory Cochin, India.The sequenced data thus obtained BLAST searched using BLAST 2.0 program [17] and the sequences were compared to those already present in the GenBank/ NCBI database.

Table 2. Amount and concentration of reaction reagents used for amplification

3. Results

Based on the use of different approaches including the conventional, biochemical, and molecular methods, a total of fifteen proteobacteria bacterial species were identified from the Lake water. The macro morphological characteristics of all the isolates were quite different and varying. In this phylum, the most diverse class isolated was Alpha-Proteobacteria (Table 3) represented by two orders Rhizobiales and Caulobacterales comprising seven species, namely Paenochrobactrum glaciei, Paenochrobactrum gallinarii, Pseudochrobactrumas accharolyticum, Pseudochrobactrum lubricantis, Amorphus orientalis, Brevundimonas versicularis, and Caulobacter daechungensi. Class Beta-proteobacteria were represented by only one order Burkholderiales contributing six species Pusillimonas soli, Alcaligenesfaecalis, A.aquatilis, Alcaligenes faecalis subspecie sparafaecalis, Alcaligenes faecalis subspecies phenolicus, and Advenella kashmirensis. However, Gamma-Proteobacteria were represented by two orders Pseudomonadales and Xanthomonadales, contributing only two species viz. Pseudomonas chengduensis and Stenotrophomonas rhizophila thus making it the least diverse class of bacteria.

A gene bank similitude of 81 to 98% with a fragment size range from 1213bp to 1290bp was shown by molecular analysis of the isolated bacterial strains (Table 4). The biochemical analysis of the bacterial species showed that all but Caulobacter daechungensis were positive for catalases. The results obtained for the bacterial species were variable for all other biochemical tests. Classical analysis however showed the rod shape and Gram-negative nature in all bacterial species (Table 5).

The maximum number of ten bacterial species was detected at site V followed by nine at site I and VI, eight species at site IV, seven species each at site III and site X, six species each at site VIII and IX and a least five species at site II and VII (Table 6).

Comparative analysis of these bacterial species at the different sampling stations revealed a wide distribution, although some species exhibited a limited distribution in some sampling stations. Three species viz. A.faecalis, A.aquatilis, A.faecalis subspecies parafaecalis showed their presence at all sampling sites while Paenochrobactrum gallinarii and Amorphus orientalis were present at only two sites showing a limited distribution.

Table 3. Isolated bacterial species and their taxonomic position

Table 4. Molecular details of isolated bacterial species from Manasbal lake

 Table 5. Biochemical tests performed on isolated bacterial strains

 Table 6. Site–specific variation in the lake bacterial community composition

4. Discussion

By phenotypic analysis, biochemical and molecular characterization, we were able to differentiate bacteria up to species level [10]. Analysis of 16S rRNA genes of the isolated strains in the present study showed their phylogenetic diversity with single major phylum Proteobacteria that were further classified into different families within classes α-proteobacteria, β-proteobacteria, and γ-proteobacteria which perform some basic functions like the global transformation of elements in nature [18]. While analyzing the proteobacteria in Lake Martel obtained similar results with the dominance of α, β, and γ-Proteobacteria classes. This phylum shows close interaction with eukaryotes, both as pathogens and as symbionts [19].

Beta-proteobacteria (purple nonsulfur bacteria) is reported from industrial effluents [20, paddy soils, 21], and riverine ecosystems, while Gamma-proteobacteria (purple sulfur bacteria) were isolated from tropical waters of Pichavaram mangroves and other coastal ecosystems [22]. Order Rhizobales of alpha-Proteobacteria includes a variety of bacterial species advantageously significant for their diversity in function and niche occupancy. Therefore, the studies of this bacterial group are crucial because they comprise not only the symbiotic nitrogen fixers but also the obligate and facultative pathogens of plants and animals. Such specific species are thus able to adapt to and use various ecologically applicable niches [23].

Altogether, the genomic comparisons among pathogenic and symbiotic bacteria represented by this order may provide huge information about genome functionality, genetic variability and operon organization of related species. Genus Amorphus [24] belonging to the class Alpha-proteobacteria were initially isolated from the Lake water and was reported as a pathogen. However, the genus Pseudomonas is a genetically diverse bacterial community of more than hundred species [25] and has a significant role in the breakdown of organic matter and in denitrification in the nitrogen cycle and plant growth promotion, they can also act as plant and animal pathogens [26].

In Beta-proteobacteria, genus Alcaligenes the most abundant and ubiquitous is found in water, soil, rotten eggs, dairy products and the intestinal tract of vertebrates where they probably live saprophytically [27], belonging to the family Alcaligenaceae, which also include genus Pusillimonas [28]. Further, it has been reported that Alcaligenesspp. Occasionally causes opportunistic infections in humans [29] hence posing severe environmental and human health concerns. Endotoxins derived from A. faecalis represent a potential risk of inflammatory respiratory reaction and lung disease for persons working in agricultural fields where they inhale organic dust contaminated with these organisms [30]. In another study conducted by Gontang et al. [31] Alcaligenes faecalis have been used as nitrite reductase in a biosensor system for the measurement of nitrite in natural waters. Phylogenetically speaking, the Stenotrophomonas genus is found in the Proteobacterial γ-subclass [32] and are omnipresent in the ecosystems and play an important ecological function in nature’s elemental cycle [33].

Species are distributed only in small numbers and completely absent from others, as the activities in the catchment have a profound impact on bacterial diversity in certain areas and their direct relation to their surroundings may be attributed to the reservoir itself. Our work was in consonance with the results of other workers as for example, Saleem et al. [34] found the developmental activities and occupancy in the area exerting pressure on the water body. Three species viz., Alcaligenes faecalis, Alcaligenes faecalis sub-species parafaecalis, and Alcaligenesaquatilisshowed wide distributed throughout the lake by showing their presence at every site. According to Alfreider et al. [35], Betaproteobacteria can be considered as ecological generalists in freshwater, while other groups are more specialized. Some workers have reported that bacteria dominate different freshwater microbial communities, phylogenetically affiliated to β-proteobacteria subclass of Proteobacteria [36].

The species of the class Gamma-Proteobacteria such as Pseudomonas chengduensis and Stenotrophomonas rhizophila were found at site VIII, where the nutrient concentration is high because of the agricultural runoff, our results are confirmed by the Pinhassi et al.[37] who found that γ-Proteobacteria have a preference for high nutrient concentration because they are typical r-strategists and are hence able to rapidly exploit the extra nutrients [38]. Besides, Pomeroy et al. [39] suggested that the interaction of substrate concentrations and temperature should be considered simultaneously while evaluating bacteria plankton responses.

5. Conclusion

In this analysis, molecular techniques targeting the 16S rRNA gene were found to be effective methods for clarifying the bacterial diversity of the lakes. The study also found that certain pathogenic bacteria are present in lake water. Anthropogenic impacts from the catchment area were evident, especially in the nutrient status in Manasbal Lake.

Acknowledgement

Acknowledgements are due to the Department of Science and Technology, GoI for the financial assistance provided vide letter no. SR/WOS-A/LS-27/2014 (G) dtd: 27/11/2015.

Conflict of interest

We declare that we don’t have any conflict of interest in the current study.

Conflict of interest

The authors declare no conflict of interest

Ethical approval

This article does not contain any studies with human participants or animals performed by any of the authors.

Consent for publications

The author read and proved the final manuscript for publication.

Availability of data and material

All data generated during this study are included in this published article

References

1. Kersters K, De Vos P, Gillis M, Swings J, Vandamme P, Stackebrandt E. (2006). Introduction to the Proteobacteria. In Dworkin M Falkow S Rosenberg E Schleifer K-H, Stackebrandt E (Eds.), The Prokaryotes: Volume 5: Proteobacteria: Alpha and Beta Subclasses (pp. 3-37). New York, NY: Springer New York. https://doi.org/10.1007/0-387-30745-1_1
2. Osborne C D, Haritos V S. (2018). Horizontal gene transfer of three co-inherited methane monooxygenase systems gave rise to methanotrophy in the Proteobacteria. Molecular phylogenetics and evolution, 129: 171-181. https://doi.org/10.1016/j.ympev.2018.08.010
3. Garrity G M, Bell J A, Lilburn T. (2015). Proteobacteria phyl. nov. Bergey’s Manual of Systematics of Archaea and Bacteria: 1-1. https://doi.org/10.1002/9781118960608.pbm00022
4. Balows A, Duerden B. (1998). Topley and Wilson’s microbiology and microbial infections, vol 2: systematic bacteriology: Arnold. 1501 pages,
5. Gray M W. (1992). The endosymbiont hypothesis revisited. International review of cytology, 141: 233-357. https://doi.org/10.1016/S0074-7696(08)62068-9
6. Brenner D J, Krieg N, Staley J, Garrity G. (2005). Bergey’s manual of systematic bacteriology, Vol 2: The Proteobacteria. NY: Springer: 1106 pages.
7. Stackebrandt E. (1993). Nucleic acids and classification. Handbook of new bacterial systematics: 151-194. NII Article ID (NAID): 10008260925
8. Zhang Y, Romero H, Salinas G, Gladyshev V N. (2006). Dynamic evolution of selenocysteine utilization in bacteria: a balance between selenoprotein loss and evolution of selenocysteine from redox active cysteine residues. Genome biology, 7(10): 1-17. https://doi.org/10.1186/gb-2006-7-10-r94
9. Lawrence W. (1895). The Valley of Kashmir (London: Asian Educational Services). 40-42.
10. Shafi S, Kamili A N, Shah M A, Bandh S A, Dar R. (2017). Dynamics of bacterial class Bacilli in the deepest valley lake of Kashmir-the Manasbal Lake. Microbial pathogenesis, 104: 78-83. https://doi.org/10.1016/j.micpath.2017.01.018
11. Association. A P H. (1998). Standard Methods for the Examination for water and waste water.4th Edition, published by APHA New York. 2671 Pages,
12. Sujatha P, Kumar B N, Kalarani V. (2012). Isolation, characterization and molecular identification of bacteria from tannery effluent using 16S rRNA sequencing. Current Biotica, 6(2): 198-207.
13. Altschul S F, Gish W, Miller W, Myers E W, Lipman D J. (1990). Basic local alignment search tool. Journal of molecular biology, 215(3): 403-410. https://doi.org/10.1016/S0022-2836(05)80360-2
14. Clesceri L, Greenberg A, Eaton A. (1998). Standard methods for the examination of water. Waste Water, AWWA, WEF, APHA, Washington DC.
15. Kirubakaran R, ArulJothi K, Revathi S, Shameem N, Parray J A. (2020). Emerging priorities for microbial metagenome research. Bioresource Technology Reports, 11: 100485. https://doi.org/10.1016/j.biteb.2020.100485
16. Shetty S P, Sturts R, Vetick M, Copeland P R. (2018). Processive incorporation of multiple selenocysteine residues is driven by a novel feature of the selenocysteine insertion sequence. Journal of biological chemistry, 293(50): 19377-19386. https://doi.org/10.1074/jbc.RA118.005211
17. Simonović M, Puppala A K. (2018). On elongation factor eEFSec, its role and mechanism during selenium incorporation into nascent selenoproteins. Biochimica et Biophysica Acta (BBA)-General Subjects, 1862(11): 2463-2472. https://doi.org/10.1016/j.bbagen.2018.03.018
18. Rivas R, García-Fraile P, Mateos P F, Martinez-Molina E, Velázquez E. (2009). Phylogenetic diversity of fast-growing bacteria isolated from superficial water of Lake Martel, a saline subterranean lake in Mallorca Island (Spain) formed by filtration from the Mediterranean Sea through underground rocks. Adv. Stud. Biol, 1: 333-344.
19. Gupta R S. (2000). The phylogeny of proteobacteria: relationships to other eubacterial phyla and eukaryotes. FEMS microbiology reviews, 24(4): 367-402. https://doi.org/10.1111/j.1574-6976.2000.tb00547.x
20. Sasikala C, Ramana C V, Chalam A, Jayasri K, Raghuveer Rao P. (1995). A survey of purple non-sulfur anoxygenic phototrophic bacteria associated with some industrial effluents. Indian Journal of Experimental Biology, 33: 136-136.
21. SASIKALA C, Archana A, RAMANA C V. (2002). Occurence of anoxygenic phototrophic bacteria in some paddy fields of Andhra Pradesh, India. Indian journal of microbiology, 42(2): 169-171.
22. Ritchie A E, Johnson Z I. (2012). Abundance and genetic diversity of aerobic anoxygenic phototrophic bacteria of coastal regions of the Pacific Ocean. Applied and environmental Microbiology, 78(8): 2858-2866. https://doi.org/10.1128/AEM.06268-11
23. Balow A, Truper H, Dworkin M, Harder W, KH S. (1992). KH: The Prokaryotes, Vol. by RA Slepecky and HE Hemphill: Springer-Verlag, New York.
24. Yosef D Z B, Ben-Dov E, Kushmaro A. (2008). Amorphus coralli gen. nov., sp. nov., a marine bacterium isolated from coral mucus, belonging to the order Rhizobiales. International Journal of Systematic and Evolutionary Microbiology, 58(12): 2704-2709.
25. Kämpfer P, Glaeser S P. (2012). Prokaryotic taxonomy in the sequencing era–the polyphasic approach revisited. Environmental microbiology, 14(2): 291-317. https://doi.org/10.1111/j.1462-2920.2011.02615.x
26. Carlson C A, Ingraham J L. (1983). Comparison of denitrification by Pseudomonas stutzeri, Pseudomonas aeruginosa, and Paracoccus denitrificans. Applied and environmental Microbiology, 45(4): 1247-1253. https://doi.org/10.1128/aem.45.4.1247-1253.1983
27. Al-Asadi S, Malik A, Bakiu R, Santovito G, Menz I, Schuller K. (2019). Characterization of the peroxiredoxin 1 subfamily from Tetrahymena thermophila. Cellular and Molecular Life Sciences, 76(23): 4745-4768. https://doi.org/10.1007/s00018-019-03131-3
28. Stolz A, Bürger S, Kuhm A, Kämpfer P, Busse H-J. (2005). Pusillimonas noertemannii gen. nov., sp. nov., a new member of the family Alcaligenaceae that degrades substituted salicylates. International Journal of Systematic and Evolutionary Microbiology, 55(3): 1077-1081. https://doi.org/10.1099/ijs.0.63466-0
29. Holt G J, Krieg R N, Sneath A H P, Staley T J, Williams T S. (1994). Bergey’s Manual Of Determinative Bacteriology. 9th ed: Williams & Wilkins: Baltimore, Maryland. 527-558,
30. Skorska C, Milanowski J, Dutkiewicz J, Fafrowicz B. (1996). Bacterial endotoxins produced by Alcaligenes faecalis and Erwinia herbicola as potential occupational hazards for agricultural workers. Pneumonologia i alergologia polska, 64: 9-18. PMID: 9190244
31. Gontang E A, Fenical W, Jensen P R. (2007). Phylogenetic diversity of gram-positive bacteria cultured from marine sediments. Applied and environmental Microbiology, 73(10): 3272-3282. https://doi.org/10.1128/AEM.02811-06
32. Moore S, Stein W H. (1948). Photometric ninhydrin method for use in the chromatography of amino acids. Journal of biological chemistry, 176(1): 367-388.
33. Ikemoto S, Suzuki K, Kaneko T, Komagata K. (1980). Characterization of strains of Pseudomonas maltophilia which do not require methionine. International Journal of Systematic and Evolutionary Microbiology, 30(2): 437-447. https://doi.org/10.1099/00207713-30-2-437
34. Saleem S, Kamili A, Kakru D, Bandh S, Ganai B. (2011). Isolation, identification and seasonal distribution of bacteria in Dal Lake, Kashmir. International journal of environmental sciences, 2(1): 185-193.
35. Alfreider A, Pernthaler J, Amann R, Sattler B, Glockner F, Wille A, Psenner R. (1996). Community analysis of the bacterial assemblages in the winter cover and pelagic layers of a high mountain lake by in situ hybridization. Applied and environmental Microbiology, 62(6): 2138-2144. https://doi.org/10.1128/aem.62.6.2138-2144.1996
36. Glöckner F O, Amann R, Alfreider A, Pernthaler J, Psenner R, Trebesius K, Schleifer K-H. (1996). An in situ hybridization protocol for detection and identification of planktonic bacteria. Systematic and applied microbiology, 19(3): 403-406. https://doi.org/10.1016/S0723-2020(96)80069-5
37. Pinhassi J, Berman T. (2003). Differential growth response of colony-forming α-and γ-proteobacteria in dilution culture and nutrient addition experiments from Lake Kinneret (Israel), the eastern Mediterranean Sea, and the Gulf of Eilat. Applied and environmental Microbiology, 69(1): 199-211. https://doi.org/10.1128/AEM.69.1.199-211.2003
38. Puddu A, Zoppini A, Fazi S, Rosati M, Amalfitano S, Magaletti E. (2003). Bacterial uptake of DOM released from P-limited phytoplankton. FEMS microbiology ecology, 46(3): 257-268.
39. Pomeroy L R, Wiebe W J. (2001). Temperature and substrates as interactive limiting factors for marine heterotrophic bacteria. Aquatic Microbial Ecology, 23(2): 187-204.